Sensitivity to Colon Carcinogenesis Folate Transport Gene Inactivation in Mice Increases

Low dietary folate intake is associated with an increased risk for colon cancer; however, relevant genetic animal models are lacking. We therefore investigated the effect of targeted ablation of two folate transport genes, folate binding protein 1 (Folbp1) and reduced folate carrier 1 (RFC1), on folate homeostasis to elucidate the molecular mechanisms of folate action on colonocyte cell proliferation, gene expression, and colon carcinogenesis. Targeted deletion of Folbp1 (Folbp1 and Folbp1) significantly reduced (P < 0.05) colonic Folbp1 mRNA, colonic mucosa, and plasma folate concentration. In contrast, subtle changes in folate homeostasis resulted from targeted deletion of RFC1 (RFC1). These animals had reduced (P < 0.05) colonic RFC1 mRNA and exhibited a 2-fold reduction in the plasma S -adenosylmethionine/ S-adenosylhomocysteine. Folbp1 and Folbp1 mice had larger crypts expressed as greater (P < 0.05) numbers of cells per crypt column relative to Folbp1 mice. Colonic cell proliferation was increased in RFC1 mice relative to RFC1 mice. Microarray analysis of colonic mucosa showed distinct changes in gene expression specific to Folbp1 or RFC1 ablation. The effect of folate transporter gene ablation on colon carcinogenesis was evaluated 8 and 38 weeks postazoxymethane injection in wild-type and heterozygous mice. Relative to RFC1 mice, RFC1 mice developed increased (P < 0.05) numbers of aberrant crypt foci at 8 weeks. At 38 weeks, RFC1 mice developed local inflammatory lesions with or without epithelial dysplasia as well as adenocarcinomas, which were larger relative to RFC1 mice. In contrast, Folbp1 mice developed 4-fold (P < 0.05) more lesions relative to Folbp1 mice. In conclusion, Folbp1 and RFC1 genetically modified mice exhibit distinct changes in colonocyte phenotype and therefore have utility as models to examine the role of folate homeostasis in colon cancer development. (Cancer Res 2005; 65(3): 887-97) Introduction Colon cancer is a major health concern in the United States and is the second leading cause of death from cancer (1). Interestingly, an insufficient supply of methyl group donors from folate has been linked to the promotion of colorectal tumorigenesis (2–8). The implications of low folate status are four-fold and include (a) alterations in global methylation (9–11), (b) impaired DNA repair (12–14), (c) enhanced cell proliferation (15, 16), and (d) impaired DNA synthesis (17, 18). There is cogent clinical and epidemiologic evidence linking low folate status to increased proliferation of colonocytes and an elevated risk for developing colon cancer in humans (4, 7, 8, 19) and in experimental animal models (2, 3, 6, 20, 21). Conversely, folate supplementation is protective. Patients at risk for colon cancer supplemented with folate were shown to have decreased colonic mucosal cell proliferation (22). In addition, rats supplemented with folate were protected against the development of macroscopic colonic tumors induced by the colon-specific carcinogen, dimethylhydrazine (2). However, the precise mechanisms by which aberrant folate status perturbs crypt cytokinetics and enhances colon cancer risk remain to be determined. Dietary intervention has been a primary means to alter folate status in rodent animal models of colon cancer (2, 3, 6, 20, 21). Of concern, these models may be prone to moderate short-term compensatory up-regulation of DNA methyltransferase activity associated with dietary induced folate deficiency (5, 6). In addition, diet-induced folate deficiency observed in rodent models is often very extreme and may not resemble the subclinical folate deficient status found in 30% of the U.S. population (23) nor the modestly reduced folate status found in some colon cancer patients (24). At present, the molecular basis of folate deficiency–mediated colon carcinogenesis is not well understood. We therefore engineered mice with targeted ablation of either the reduced folate carrier 1 (RFC1) or folate binding protein 1 (Folbp1) gene to elucidate the molecular and cellular mechanisms of folate action on colonocyte cell proliferation, gene expression, and colon carcinogenesis. RFC1 and Folbp1 are well-characterized folate transporters (25–27). RFC1 is a facilitative anion exchanger that mediates folate delivery into a variety of cells, including colonocytes (27), and has a high affinity for reduced folates, such as the primary physiologic substrate, 5-methyltetrahydrofolate (27). In comparison, folate receptors (Folbp1 and Folbp2 in mice and a and h in humans) are coupled to the plasma membrane via a glycosylphosphatidylinositol linkage and transport folic acid and 5-methyltetrahydrofolate with high affinity (28). Folbp1 is highly expressed in the kidney proximal tubule (28) but not in the small intestine (29, 30) and is found in low levels in the colon (31). Note: D.W.L. Ma is currently at Department of Nutritional Sciences, University of Toronto, Toronto, Ontario, Canada. O. Spiegelstein is currently at Teva Pharmaceutical Industries, Netanya, Israel. J.M. Salbaum and C. Kappen are currently at Department of Genetics, Cell Biology and Anatomy, Munroe-Meyer Institute, University of Nebraska Medical Center, Omaha, Nebraska. Requests for reprints: Robert S. Chapkin, Molecular and Cell Biology Section, Faculty of Nutrition, Texas A&M University, Kleberg Center, TAMU 2471, College Station, TX 77843-2471. Phone: 979-845-0448; Fax: 979-862-2662; E-mail: [email protected]. I2005 American Association for Cancer Research. www.aacrjournals.org 887 Cancer Res 2005; 65: (3). February 1, 2005 Research Article American Association for Cancer Research Copyright © 2005 on February 23, 2013 cancerres.aacrjournals.org Downloaded from Using these mouse models, we were able to show that inactivation of cellular folate transport mechanisms (RFC1 and Folbp1) perturbs folate status, alters colonic cytokinetics, and increases the development of preneoplastic biomarkers of colon cancer. The results of this study highlight the utility of these mouse models to examine the relationship between compromised folate homeostasis and colon cancer development. Materials and Methods Animals and Diet. Genetically modified C57BL/6J 129/Sv Folbp1 and SWV/Fnn RFC1 male mice, 80 to 100 days old, were housed in a temperature and humidity controlled animal facility with a 12-hour light/ dark cycle and initially fed defined diets (Harlan Teklad, Indianapolis, IN) containing 2.7 mg folate/kg. Animals enrolled into the carcinogen phase of the study were maintained on a semipurified defined diet (Harlan Teklad) containing 2.0 mg folate/kg, 44.57 (g/100 g diet) corn starch, 15.0 casein, 15.5 sucrose, 15.0 corn oil (Degussa Bio Actives, Champaign, IL), 5.0 fiber (cellulose), 3.5 AIN-93 mineral mix, 1.0 AIN-93-VX mineral mix, 0.25 choline bitartrate, and 0.18 L-cysteine. All procedures were done in accordance with the animal experimentation guidelines of Texas A&M University. Folbp1 and RFC1 Mice. The generation of Folbp1 knockout mice has been described previously (9, 32). Folbp1 / mice are embryonic lethal but may be rescued by supplementation of dams with folate 2 weeks before mating and throughout pregnancy, and pups do not require further folate supplementation (9, 32). Therefore, these mice have limited utility and were only used for basic characterization purposes in this study. The generation of RFC1 knockout mice is described herein. RFC1 / mice are also embryonic lethal; however, supplementation of dams with various folate sources does not yield viable offspring (data not shown); thus, no data are presented for RFC1 / mice in this study. In a comparable RFC1 knockout mouse model, Zhao et al. (33) also reported that folate rescue of RFC1 / mice is not possible. Cloning of RFC1. A bacteriophage Pl library (Genome Systems, St. Louis, MO) prepared from the inbred mouse strain 129/Sv genomic DNA was screened by PCR with primers specific for exon 3 of mouse RFC1 (TGCGATACAAGCCAGTCTTGG and GCACCAGGGAGAATATGTAGGAGG). We identified one positive clone containing an 80-kb insert. Digestion of the clone with HindIII and probing with exon 3 identified a 7.5-kb fragment containing exons 3 and 4 (Fig. 1). This fragment was subcloned into pBluescript (Stratagene, La Jolla, CA) and used to develop a Cre-loxP-based conditional knockout targeting construct. The RFC1 clone was restriction mapped and a loxP-flanked neo-TK was introduced into the unique AocI site. An additional loxP site was introduced into the NsiI site located downstream from exon 4 by partial digestion, thus also ensuring that the NsiI site was destroyed. The targeting construct (Fig. 1) was linearized with HindIII and introduced into the E14 ES cell line. Electroporation and Validation. The ES cell line, E14TG2a, was used and cells were maintained in DMEM supplemented with 15% fetal bovine serum, 0.1 mmol/L 2-mercaptoethanol, and 2 mmol/L glutamine. ES cells were cocultured with embryonic fibroblast feeders as described previously (34). Cells were electroporated essentially as described by Reid et al. (35) using linearized DNA at a final concentration of 2 to 5 nmol/L. Electroporated cells were plated at a density of 1 10 to 2 10 cells per 10 cm plate. Twenty-four hours after electroporation, cells were placed in 150 Ag/mL G418. After 7 to 10 days, G418-resistant colonies were selected for expansion and analysis. From 1,350 colonies resistant to G418, 162 were analyzed by Southern blot and 4 were found to be targeted. Targeted colonies were identified by genomic Southern blotting. As shown in Fig. 1 for the initial targeting event, digestion with SacI, XmaI, or NdeI and probing with exon 2 can differentiate between the endogenous allele and the targeted allele. Once a targeted colony was identified, it was expanded and electroporated with 3 nmol/L Cre-expressing plasmid (36). Following electroporation, cells were placed in ganciclovir to select for loss of the neoTK insert. Of 60 clones analyzed, 33 had lost the neo-TK but not exons 3 and 4, whereas 27 clones had lost both the neo-TK insert and exons 3 to 4. The latter colonies were further expanded and injected into C57BL/6 blastoacysts, and chimeric progeny were bred to C57BL/6 to ascertain germ line transmission of the mutant allele. The resulting lines were maintained on a SWV/Fnn background. As shown in Fig. 1C , the deletion event resulted in the complete removal of exons 3 and 4 of the RFC1 gene. This deleted allele was differentiated from the endogenous allele using an ApaI digest and probing with exon 2. Folate, S-Adenosylmethionine, and S-Adenosylhomocysteine Assays. The total folate levels in plasma were determined using the Lactobacillus casei turbidimetric assay (37) with slight modification as described previously (38). Plasma concentrations of S-adenosylmethionine (SAM) and S-adenosylhomocysteine (SAH) were determined by high-pressure liquid chromatography using electrochemical detection as described previously (39). Tissue folate levels were determined using scraped colonic mucosa as described previously (40). Tissue SAM and SAH were also quantified (41). Measurement of Colonic Cell Cytokinetics. In vivo cell proliferation was determined by immunohistochemical detection. Mice were injected i.p. with bromodeoxyuridine (BrdUrd, 50mg/kg bodyweight). Mice were terminated 1 hour after injection. Colons were excised, slit open longitudinally, and rinsed thoroughly in cold PBS. Colons were then fixed in paraformaldehyde and embedded in paraffin as Swiss rolls (42, 43). The incorporation of BrdUrd into DNA of actively dividing cells was determined using a commercially available kit (Zymed, South San Francisco, CA). Crypt size and proliferative activity in distal sections were determined as described previously (44). Quantitative Real-time PCR. Expression of Folbp1 and RFC1 in knockout mice was determined using mRNA isolated from colonic mucosa and whole kidneys. In addition, selected genes implicated in colon cancer development and regulated by CpG promoter methylation were quantified by real-time PCR. These genes included E-cadherin (Cdh1), caudal type homeobox 1 (Cdx1), decorin (Dcn), estrogen receptor-1a (Esr1), insulin-like growth factor-II (Igf2), N-myc downstream regulated 2 (Ndr2), phosphoinositide 3V-kinase catalytic polypeptide (Pik3cg ), and prostaglandinendoperoxide synthase 2 (Ptgs2). Isolation and analysis of RNA was done as described previously by Davidson et al. (45). RNA was isolated using the Totally RNA extraction kit (Ambion, Austin, TX). Total RNA was quantified with the Agilent 2100 Bioanalyzer. Real-time PCR was done using the ABI 7700 (Applied Biosystems, Foster City, CA) and Taqman Probes (Assays-onDemand, Applied Biosystems). Figure 1. Targeted inactivation of the murine RFC1. A, endogenous genomic loci. B, targeted RFC1 loci before Cre-mediated excision. Thick line, targeting construct; arrowhead, location of loxP sites. C, targeted locus following Cre-mediated excision. Cancer Research Cancer Res 2005; 65: (3). February 1, 2005 888 www.aacrjournals.org American Association for Cancer Research Copyright © 2005 on February 23, 2013 cancerres.aacrjournals.org Downloaded from CodeLink Microarray Analysis. Colonic mucosa from f100-day-old adult mice was processed in strict accordance to the CodeLink Gene Expression Assaymanual (Amersham, Piscataway, NJ) and analyzed using the Mouse UniSet 10K Expression Bioarray. Each array contained a broad range of genes (f10,000) derived from publicly available, well-annotated mRNA sequences. Microarray analyses were done on colonic mucosa comparing gene expression in Folbp1 versus Folbp1 and in RFC1 versus RFC1 mice (n = 3 for each genotype). For local background subtraction, median intensity values from all background pixels of a particular gene were subtracted from the median signal for that gene; effective signals <0 were increased to 1 using a floor function to avoid downstream ‘‘division by 0’’ or ‘‘logs of 0’’ errors. Globalmedian scaling factorswere computed for each array separately. Every effective gene signal was divided by its corresponding scaling factor for normalization. Standard ratios were calculated as the median signal for the heterozygous group divided by themedian signal for the wild-type group. The ratios were logged (base 2) to transform the data into an equidistant domain. Average intensities were calculated as Ia = sqrt(I1 I2) (46). Probability estimates for each gene were determined by Student’s t test, where the resulting P was solely used for relative ranking purposes. The data sets were filtered based on the following criteria: (a) genes with P > 0.05 were excluded, (b) genes with an average intensity below the median expression intensity of all genes on the same array were excluded, and (c) genes with >2fold differential expression were excluded. Carcinogen Treatment, Aberrant Crypt, and Histologic Analyses. Adult male mice, f100 days old, were injected with the carcinogen, azoxymethane. Mice received an initial s.c. injection of azoxymethane at 10 mg/kg body weight followed by a second injection of 5 mg/kg body weight 7 days later. Eight weeks after the second azoxymethane injection, mice were terminated for aberrant crypt foci (ACF) analysis. The colon was excised and flushed with cold PBS, inflating it to twice its normal diameter. Fecal pellets were worked up and down to break the circular muscle fibers and to remove mucin adhering to the epithelium. The colon was slit longitudinally and fixed flat between two pieces of Whatman No. 1 filter paper and placed under a glass plate in 4% paraformaldehyde for 4 hours. The fixed tissue was then washed in 50% ethanol four times followed by three washes with 70% ethanol. Each wash was 20 minutes in duration. Fixed colons were stained with 0.2% methylene blue in PBS for 5 minutes and then placed on a light microscope equipped with a clear grid and visualized under low magnification (47). ACFs were scored for total number and multiplicity (number of crypts per focus) as described previously (48). Thirty-eight weeks after the last azoxymethane injection, mice were terminated and colons were excised, slit longitudinally, and flushed with PBS. Lesions were mapped, excised, and fixed in 4% paraformaldehyde as Figure 2. Expression of Folbp1 and RFC1 in knockout mice. Expression was determined by quantitative real-time PCR as described in Materials and Methods. A, Folbp1 mRNA expression in the colon in Folbp knockout mice. B, RFC1 mRNA expression in the colon in RFC1 knockout mice. C, relative expression of Folbp1 and RFC1 in colonic mucosa and kidney in wild-type animals. Columns, mean (n = 5-8) normalized to 18S rRNA expression; bars, SE. Table 1. Plasma and tissue folate, SAH, and SAM in Folbp and RFC1 knockout mice Folbp1 Folbp1 Folbp1 / RFC1 RFC1 Plasma Folate (ng/mL) 30.4 F 2.0 17.0 F 2.8 10.4 F 0.5 21.6 F 7.6 28.6 F 2.4 SAH (nmol/L) 41.4 F 8.8 51.4 F 6.9 32.6 F 3.1 23.7 F 4.2 41.5 F 9.7 SAM (nmol/L) 49.5 F 9.4 79.7 F 12.7 42.5 F 1.6 124.1 F 9.5 101.0 F 5.5 SAM/SAH 1.4 F 0.4 1.6 F 0.2 1.3 F 0.1 5.8 F 1.3 2.7 F 0.5 Colonic mucosa Folate (ng/mg protein) 19.2 F 2.2 13.1 F 0.8 10.5 F 0.4 11.9 F 2.2 10.0 F 1.8 SAH (pmol/mg tissue) 3.8 F 0.8 4.4 F 0.6 5.7 F 1.0 8.8 F 0.6 9.6 F 0.6 SAM (pmol/mg tissue) 14.3 F 3.1 21.5 F 2.2 21.6 F 1.7 17.1 F 1.6 19.0 F 1.4 SAM/SAH 5.3 F 2.1 5.2 F 0.7 4.4 F 0.6 1.9 F 0.1 2.1 F 0.2 NOTE: Scraped colonic mucosa and blood plasma from mice fed chow diets containing 2.7 mg folate/kg were analyzed for folate content using a standard microbiological bioassay as described in Materials and Methods. Plasma SAH and SAM were determined by HPLC as described in Materials and Methods. Mean F SE (n = 2-7). Mouse models with different letters are significantly different (P < 0.05) within a row. Folate Transport Gene Ablation in the Colon www.aacrjournals.org 889 Cancer Res 2005; 65: (3). February 1, 2005 American Association for Cancer Research Copyright © 2005 on February 23, 2013 cancerres.aacrjournals.org Downloaded from described above. H&E-stained sections were subsequently viewed and blindly scored by a board-certified pathologist. Statistical Analysis. Data were analyzed using the least significant difference test on multiple means, and the Student’s t test (one-tailed) was used in analyses with two means. Data are expressed as mean F SE. Results Expression of RFC1 and Folbp1 in the Colon and Kidney. Data presented in Fig. 2 show that allelic ablation of Folbp1 (Fig. 2A) and RFC1 (Fig. 2B) result in the expected reduction in the Figure 3. Effect of targeted inactivation of Folbp1 and RFC1 on colonic cell proliferation. A, representative photomicrographs ( 200) of colonic crypts stained for BrdUrd. Arrows, cycling cells stained with BrdUrd. Labeling index or percentage of colonic cells proliferating [Folbp mice (B) and RFC1 mice (C)] is percentage of BrdUrd-stained cells relative to the total number of cells per crypt column. Proliferative zone data [Folbp mice (D ) and RFC1 mice (E)] are the measure of the highest labeled cell within the crypt divided by the total number of cells within a crypt ( 100). This provides an indication of the size of the proliferative compartment within the crypt column. Absolute number of cells in a crypt column [Folbp mice (F ) and RFC1 mice (G )] is the overall size of the crypt. Comparisons are not made between Folbp and RFC1 genotypes because these animals are on different genetic backgrounds. Below each column, genotype, number of animals, total number of crypts scored, and mean F SE. *, P < 0.05, relative to wild-type animals. Table 2. Differentially expressed genes in RFC1 and RFC1 mice Accession no. Symbol Gene description Fold change, heterozygous/wild-type P Transcription/translation NM_011543 Skp1a S-phase kinase-associated protein 1A 0.44 0.04 NM_009099 Trim30 Tripartite motif protein 30 0.36 0.01 Immune response NM_010724 Psmb8 Proteosome (prosome, macropain) subunit, h type 8 (large multifunctional protease 7) 0.43 0.05 NM_010738 Ly6a Lymphocyte antigen 6 complex, locus A 0.49 0.04 G-protein signaling NM_008330 Olfr56 Olfactory receptor 56 0.49 0.01 NM_007588 Calcr Calcitonin receptor 2.85 0.04 Others NM_013864 Ndr2 N-myc downstream regulated 2 (cell differentiation) 2.17 0.04 NOTE: Genes were selected based on a significant (P < 0.05) and a differential fold change in expression >2 or <0.5. From each genotype, colonic mucosa from three noninjected (100-day-old baseline) mice was collected and processed for RNA isolation. Fold change refers to the normalized signal intensity of a given gene in RFC1 (heterozygous) relative to RFC1 (wild-type) mice. Cancer Research Cancer Res 2005; 65: (3). February 1, 2005 890 www.aacrjournals.org American Association for Cancer Research Copyright © 2005 on February 23, 2013 cancerres.aacrjournals.org Downloaded from Table 3. Differentially expressed genes in Folbp1 and Folbp1 mice Accession no. Symbol Gene description Fold change, heterozygous/wild-type P Apoptosis NM_010062 DNase2a DNase IIa 0.49 0.01 NM_011050 Pdcd4 Programmed cell death 4 0.39 0.01 NM_007465 Birc3 Baculoviral IAP repeat-containing 3 0.35 0.02 Cell adhesion NM_009675 Aoc3 Amine oxidase, copper-containing 3 2.11 0.05 NM_008483 Lamb2 Laminin, h2 0.43 0.03 Cell cycle/cell proliferation NM_013525 Gas5 Growth arrest–specific 5 2.35 0.005 AF236887 Atr Ataxia telangiectasia and Rad3 related 0.42 0.03 NM_011369 Shcbp1 Shc SH2-domain binding protein 1 0.39 0.02 NM_010784 Mdk Midkine 0.38 0.03 Nucleotide metabolism and transport AB020203 Ak3l Adenylate kinase 3a like 2.66 0.01 NM_053103 Lysal2 Lysosomal apyrase-like 2 2.00 0.01 NM_007398 Ada Adenosine deaminase 0.45 0.05 NM_016690 Hnrpdl Heterogeneous nuclear ribonucleoprotein D like 0.44 0.04 DNA binding NM_009561 Zfp61 Zinc finger protein 61 0.48 0.04 NM_020618 Smarce1 SWI/SNF-related, matrix-associated, actin-dependent regulator of chromatin, subfamily E, member 1 0.45 0.04 NM_015781 Nap1l1 Nucleosome assembly protein 1 like 1 0.42 0.01 NM_021790 Solt SoxLZ/Sox6 leucine zipper binding protein in testis 0.37 0.04 RNA binding NM_024199 Cstf1 Cleavage stimulation factor, 3V pre-RNA, subunit 1 2.05 0.01 AK008240 Snrpf Small nuclear ribonucleoprotein polypeptide 0.45 0.04 Transcription/translation AK011545 Basp1 Neuronal axonal membrane protein (Nap-22) 0.31 0.03 NM_009385 Titf1 Thyroid transcription factor 1 2.95 0.02 NM_011297 Rps24 Ribosomal protein S24 0.45 0.03 D83146 Six5 Sine oculis-related homeobox 5 homologue (Drosophila) 0.43 0.02 AK019500 Syncrip Synaptotagmin binding, cytoplasmic RNA interacting protein 0.39 0.01 S66855 Hoxb9 Homeobox B9 0.31 0.05 Eicosanoid NM_010160 Cugbp2 CUG triplet repeat, RNA binding protein 2 0.23 0.02 AF233645 Cyp4f15 Cytochrome P450, family 4, subfamily F, polypeptide 15 0.13 0.05 Glycosylation NM_009178 Siat4c Sialyltransferase 4C (h-galactoside a-2,3-sialytransferase) 3.74 0.02 NM_009176 Siat6 Sialyltransferase 6 (N-acetyllacosaminide a-2,3-sialyltransferase) 2.71 0.01 NM_028189 B3gnt3 UDP-GlcNAc:hGal h-1,3-N-acetylglucosaminyltransferase 3 2.54 0.005 AK006263 Siat10 Sialyltransferase 10 (a-2,3-sialyltransferase VI) 2.29 0.05 G-protein related AK008273 Arhgdib Rho, GDP dissociation inhibitor (GDI) h 0.32 0.01 NM_010336 Edg2 Endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor, 2 0.32 0.002 NM_008376 Imap38 Immunity-associated protein 0.28 0.0004 Immune function NM_009399 Tnfrsf11a Tumor necrosis factor receptor superfamily, member 11a 4.39 0.02 NM_008532 Tacstd1 Tumor-associated calcium signal transducer 1 3.48 0.01 NM_007657 Cd9 CD9 antigen 3.39 0.01 AJ006130 Ik IK cytokine 0.48 0.003 NM_011157 Prg Proteoglycan, secretory granule 0.46 0.003 NM_008510 Xcl1 Chemokine (C motif) ligand 1 0.41 0.01 NM_017372 Lyzs Lysozyme 0.30 0.03 NM_019391 Lsp1 Lymphocyte-specific 1 0.25 0.03 NM_013590 Lzp-s P lysozyme structural 0.25 0.04 NM_013706 Cd52 CD52 antigen 0.25 0.01 (Continued on the next page) Folate Transport Gene Ablation in the Colon www.aacrjournals.org 891 Cancer Res 2005; 65: (3). February 1, 2005 American Association for Cancer Research Copyright © 2005 on February 23, 2013 cancerres.aacrjournals.org Downloaded from Table 3. Differentially expressed genes in Folbp1 and Folbp1 mice (Cont’d) Accession no. Symbol Gene description Fold change, heterozygous/wild-type P